Goodreads helps you keep track of books you want to read.
Start by marking “This Cruel Design (This Mortal Coil, #2)” as Want to Read:
This Cruel Design (This Mortal Coil, #2)
Enlarge cover
Rate this book
Clear rating
Open Preview

This Cruel Design

(This Mortal Coil #2)

by
4.37  ·  Rating details ·  238 Ratings  ·  104 Reviews
Cat thought the Hydra epidemic was over, but when new cases pop up, Cat must team up with an enemy to fix the vaccine before the virus spirals out of control in this thrilling sequel to This Mortal Coil, which New York Times bestselling author Amie Kaufman says “redefines ‘unputdownable.’”

The nightmare of the outbreak is finally over, but Cat’s fight has only just begun.

Ex
...more
Hardcover, 394 pages
Published October 30th 2018 by Simon Pulse
More Details... edit details

Friend Reviews

To see what your friends thought of this book, please sign up.

Reader Q&A

To ask other readers questions about This Cruel Design, please sign up.
Popular Answered Questions
Emily Suvada Hi! Congrats on winning This Cruel Design! Unfortunately this book is a sequel in the truest sense of the word and it won't make much sense without…moreHi! Congrats on winning This Cruel Design! Unfortunately this book is a sequel in the truest sense of the word and it won't make much sense without having read This Mortal Coil. (less)

Community Reviews

Showing 1-30
Rating details
Sort: Default
|
Filter
Camila Roy ••RoyIsReading••
CAN THIS COME OUT RIGHT NOW PLEASE?? 😩 That cover is so gorgeous
Emily Suvada
Oct 29, 2018 added it  ·  (Review from the author)
AGACAGCTTGGTCATCTCCGTACCACCTCATGACCCACATATGTATATAGGTACAGAGCACGAGTGCACTTCTCGTCGTAACCGCAAGACGGAAGGAGCCACTGTCCCTCCAAGGAAATGAGGATGTTTCCATAACTTCAGGCAACGATAGGACCTGGCCACGACGAGATCAGCGGACGCTACGTGCCTATTACGTAGTGAGGTTACGACCTGTTGTGCTAAACACGAGGATTTCATATTAGGTTGCTAGCAGGCCACGGAAGTAACTAATTTCCAGCACTGCTGGGCTGGGTAGATGCAAGTGATGTAAAC
mith
i have no idea what happened in this book but a lot of it was wild so i guess that's something. suvada does not fail to keep readers on their toes, that's for sure.
Vicky Who Reads
Feb 08, 2018 rated it really liked it
Shelves: arcs, wishlist
hey hey if you want to read Emily Suvada's awesome guest post, a THIS MORTAL COIL SURVIVAL GUIDE, you can find it here!

4 stars

Emily Suvada is honestly my favorite writer for plot twists and cliffhangers and all sorts of action-y goodness. And she totally pulled through with This Cruel Design, throwing us all sorts of twists and turns and cliffhangers (so many cliffhangers) that I just ate up.

Seriously. If you thought book 2 would be any less exciting than book 1, you're very wrong.

Although I did
...more
Abbie (boneseasonofglass)
So Excitedddd!!!!

I'm liking the title!
Aoife
4.5 Stars

I received this book from Penguin Random House in exchange for an honest review.

This Cruel Design is the much anticipated sequel to bestselling YA dystopian This Mortal Coil which followed teenager Catarina as she tried to survive in a world where humans' bodies are ran by special, encoded tech but a virus with no cure is ravaging the world and causing people to form zombie-like habits before exploding, literally. Catarina's father is a world-renowned scientist who may be humanity's la
...more
Madison
May 17, 2018 rated it it was amazing
Absolutely stunning. This Cruel Design is the epic second book in the This Mortal Coil series and it is every bit as incredible, well-written, and addictive as the first book. This Cruel Design lived up to every expectation and high standard set by its predecessor. Fast-faced and intelligent, This Cruel Design ramps up the tension and the stakes, introducing new characters and pushing the boundaries on everything once thought possible for genetics and technology.

Cat might have found a vaccine fo
...more
Shannon (It Starts At Midnight)
You can find the full review and all the fancy and/or randomness that accompanies it at It Starts at Midnight

You know that super rare feeling where a sequel is as awesome as the first book in a series? Where it doesn't suffer from that "second book slump"? Such a unicorn, right? WELL. It happens here, friends! After the amazing twistiness that was This Mortal Coil, I was kiiiind of unsure if the author could replicate such amazing plot twists and surprises. Could she keep the characters develop
...more
Kath Elizabeth
Nov 08, 2018 rated it really liked it  ·  review of another edition
Shelves: owned-physical
An epic second instalment to this series! This Cruel Design starts one week after the events of This Mortal Coil, and it doesn't let up on action until the very end. Like the first book, this world is incredibly exciting and incredibly clever. Emily Suvada sure knows her science - I managed to keep up (just about) but its pretty complex.

Gene hacking, fighting, explosions, zombies, viruses - this book has all the action you could want, and a great big twist at the end that will leave you reeling
...more
Katherine Moore
My mind is blown AGAIN by Emily Suvada and her sci-fi genius. This is a stunner.


FINALLY! IT IS HERE! It’s the #bookbirthday for one of my most anticipated reads of the year, This Cruel Design, the follow-up to the brilliant This Mortal Coil (which you must read first)!

In this twisty, smart sci-fi, Cat is caught in the middle of an outbreak, struggling to find out her true identity. Find my Q&A with Emily Suvada here 👉🏼

http://kamoorephoto.booklikes.com/pos...
Rae
Oct 08, 2018 rated it it was amazing
Shelves: 2018, arc, bt-e-book, fiction
This Cruel Design by Emily Suvada picks up where This Mortal Coil left off. With Lachlan on the run and a mutated strain of virus on the loose, it's up to Cat to save everyone above ground.

To put it quite simply: this book was SO good! I had a hard time putting it down and couldn't wait to find out what misadventures Cat and her unlikely team got into. This was a book of answers, and I was pleased to learn more about Cat, her past, her family, and her motivations. I had a lot of questions coming
...more
Princess
Oct 16, 2018 rated it really liked it
I received a copy of this from Edelweiss and Simon Pulse in exchange for my honest review..

Oh wow! I don't even know what to say. There were so many twists and turns and I honestly have no idea who I can trust in this book. Not even the main character. There was so much violence. How many times can 2 people almost die in this book. The story plot is exciting and I cant wait to see how it will actually end, but wow....
 ⇝LEAH⇜
I seriously loved the first book in this series...and I almost, but not quite, loved the second book, too.  When I wrote about This Mortal Coil, I said this was completely comprehensible and seriously compelling story, especially for a book involving gene hacking, splicing, decoding and lots of technical terms and such.  I wish I could say that this book was the same for me...and it almost was, I just got a little lost in the beginning (and maybe, a little throughout)...but, eventually things st ...more
Erin
This review has been hidden because it contains spoilers. To view it, click here.
Shelley
*Source* Publisher
*Genre* Young Adult / Science Fiction
*Rating* 3.5-4

*FTC*

What a cruel, cruel, cruel ending. I have no words except wow.
Breanna
Oct 04, 2018 rated it really liked it
Shelves: arcs
THIS REVIEW & MORE → Paws and Paperbacks

ARC provided by the publisher through NetGalley.

I started this immediately after finishing This Mortal Coil, and finished it within a day, so that should tell you all you need to know about my feelings about this book. This Cruel Design was just as fast-paced, well-written, and absolutely addicting as the first book.

The book picks up right where This Mortal Coil leaves off, and the action begins almost instantaneously. Readers have no cause to worry as
...more
Jenniely
Sep 24, 2018 rated it it was amazing
Ahhhh I need to write my review for this! You have just enough time to preorder and get goodies before it comes out!!
Ayla Cato
Nov 10, 2018 rated it really liked it
OMG. The overshadowing in this series is perfect. No out of the blue twists, but the AHA! ones. The technology is just wow. Everything fits, everything makes sense. No detail is without purpose.

× What I loved:
- the technology
- the realistic worldbuilding
- the role of human psychology
- the speculative take on our future if humankind keeps messing with nature
- the conflict of various opinions on our existence
- 'mad' scientists with good intentions that diverge
- all the unique ideas (honestly, orig
...more
Siobhan Bejr
Aug 19, 2018 rated it really liked it
I thankfully had the amazing opportunity of reading a proof copy!
In 'This Mortal Coil' I found that Emily's biggest issues was the random input of things into the story. Often things that were needed to make everything work but put in like a last minute resort with no tactic of blending. While having an amazing story line and wicked plot twists, it had been on the verge of being too complicated and almost having too many 'out of left field' twists that would easily have confused a reader.
I'm hap
...more
Aryana Parmar
Oct 30, 2018 rated it it was amazing
Wow, this was such a good sequel to This Mortal Coil! I loved it!

*Thanks Feather Stone for letting me borrow it.*
ambsreads
Nov 04, 2018 rated it really liked it
so much damn science
full review to come
Genna
Sweet Jesus, that ending! I’m screaming.
_____________________

The wait for this will probably kill me. LOVE this cover design!
Christina (Ensconced in Lit)
Oct 09, 2018 rated it it was amazing
Shelves: publisher-sent
Ever since I finished This Mortal Coil, I've been dying for the second book in the series. It doesn't disappoint and is as good as the first. There is definitely no sophomore slump here.
Once again, I am astounded how Suvada seamlessly weaves together genetics, programming into a meld of sci fi and dystopian. A lot of authors attempt it and most fail. She doesn't. The world feels real and possible to me, the way she writes it, and a lot more terrifying because of it. The characters are terrific a
...more
Maxine
Sep 19, 2018 rated it it was amazing
In a future where everyone has technology embedded in them, a virus had wiped out much of the population. A vaccine had been discovered to stop it but now the virus has mutated. Eighteen-year old Catarina (Cat), a brilliant coder, and her friends are in a race to find a permanent solution to the virus before a powerful organization enacts its own solution.

This Cruel Design by Emily Suvada is one unputdownable YA scifi read. It’s a well-written well-plotted tale with a breakneck pace that rarely
...more
Bethany
Nov 05, 2018 rated it it was amazing  ·  review of another edition
I seriously hope someone makes this series into a TV show because it would be SO GOOD!!! Emily Suvada is bringing game to YA sci-fi with technology that feels feasible and based loosely on the real science of today. For those who are not familiar with This Mortal Coil, it takes place in the wake of a pretty horrific plague that has decimated much of humanity, in a world where genetic technology is commonplace. There is action, romance, drama, intrigue, basically all the things you want in a book ...more
Nikki
Nov 05, 2018 rated it it was amazing  ·  review of another edition
I had forgotten just how much I loved this mortal coil until I opened this cruel design and was sucked right back in! I knew I loved it, but forgot how well written it was, and how rich the world was.

I also love that it’s sci fi and not set in space! 👍🏻👍🏻👍🏻

The gene hacking bio tech world of this series is wonderful - I’d definitely not want to live there, but it’s so clever and different. I really felt for Cat, she’s always playing catch up and feeling a step behind. But she’s loyal and brave,
...more
Sarah Hollowell
This was such a wonderful, exciting sequel. Second books in trilogies can often feel like they're just a bridge from one book to the next, without having much identity of their own, and they can drag because of that.

THIS CRUEL DESIGN? It did not do that. It's a fast-paced book and once you get to a certain point you can't stop reading. Or at least I couldn't. There were so many revelations and twists happening, but they didn't feel overwhelming or contrived, they were just EXCITING.

I am very re
...more
Kris
Oct 22, 2018 rated it it was amazing
"Erasing memories is easy- but suppressing them is hard." I felt the need to start here with this review because this is the main focus, in my mind of this book. A lot of betrayal has happened since book one started so Catarina is in a place where she doesn't know who she can trust even more than the last book. I love that the second book started with a bit of a re-cap of the first book. Even if I hadn't read This Mortal Coil right before this one, I would be able to pick right up.

I found this b
...more
Clephiro (The Book Coven)
Sep 11, 2018 rated it really liked it
Shelves: arc, ya, scifi
I firstly want to applaud the author's work on the science in the book. The best science fiction happens when the science fiction could potentially be the technology of tomorrow. A lot of the concepts related to genes in the book are based on areas of active research in the science community So I'm definitely impressed by the author's development of science concepts in the book.

The writing was pretty solid, the only issue I really had with the book is the fact that the first 20 or so pages compl
...more
Amanda (MetalPhantasmReads)
Oct 24, 2018 rated it really liked it
*I received an ARC of this book through the publisher via NetGalley and the Fantastic Flying Book Club for a blog tour book review. All thoughts and opinions are my own**
*4.5 stars*
Holy hell people! What just happened?! There wasn't much room to breathe. Review is now on the blog!
http://metalphantasmreads.wordpress....
« previous 1 3 4 5 6 7 8 next »
There are no discussion topics on this book yet. Be the first to start one »
359 followers
Emily Suvada was born and raised in Australia, where she went on to study mathematics and astrophysics. She previously worked as a data scientist, and still spends hours writing algorithms to perform tasks which would only take minutes to complete on her own. When not writing, she can be found hiking, cycling, and conducting chemistry experiments in her kitchen. She currently lives in Portland, OR ...more

Other books in the series

This Mortal Coil (4 books)
  • This Mortal Coil (This Mortal Coil #1)
  • These Precious Scars (This Mortal Coil #0.5)
  • Untitled (This Mortal Coil #3)
Trigonometry | Stop The World | Ginnifer Goodwin